mito cfp plasmid (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
mito cfp plasmid
Mito Cfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mito+cfp+plasmid/pclbw-mitoCFP+(Plasmid+%2358426)/pmc09977882-249-0-5
Average 93 stars, based on 6 article reviews
Mito Cfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mito+cfp+plasmid/pclbw-mitoCFP+(Plasmid+%2358426)/pmc09977882-249-0-5
Average 93 stars, based on 6 article reviews
mito cfp plasmid - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: ANKLE1 cleaves mitochondrial DNA and contributes to cancer risk by promoting apoptosis resistance and metabolic dysregulation Article Snippet: The pEGFP-C1 plasmid (Clontech V012024) was used as the control. sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′- TTCAGGGCACAGCCTAGAAC -3′ and 5′- GATTCTGCCCTAGCCCCACC -5′) into the pX458 vector (Addgene Plasmid #48138 ). .. |